SMARTer™ RACE cDNA Amplification Kit

SMARTer™ RACE cDNA Amplification Kit User Manual Cat. Nos. 634923 & 634924 PT4096-1 (PR053541) Published June 2010 Now including Random Primers & SMARTScribe™ Reverse Transcriptase! United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Ave. Mountain View, CA 94043 Technical Support (US) E-mail: tech@clontech.com www.clontech.com U se r M an u al SMARTer™ RACE cDNA Amplification Kit User Manual Protocol No. PT4096-1 www.clontech.com Clontech Laboratories, Inc. Version No. PR053541 A Takara Bio Company 2 I. List of Components ..................................................................................................................3 II. Additional Materials Required .................................................................................................4 III. Introduction & Protocol Overview ..........................................................................................5 IV. Primer Design ...........................................................................................................................8 A. Primer Sequence ................................................................................................................................. 8 B. Location of Primer Sequences within Genes ........................................................................................ 9 C. Touchdown PCR ................................................................................................................................ 9 D. Nested Primers .................................................................................................................................... 9 V. Generating RACE-Ready cDNA .............................................................................................. 10 A. General Considerations ..................................................................................................................... 10 B. Preparation & Handling of Total and Poly A+ RNA .......................................................................... 10 C. Assessing the Quality of the RNA Template ...................................................................................... 11 D. PRoToCoL: First-Strand cDNA Synthesis ....................................................................................12 VI. Rapid Amplification of cDNA Ends (RACE)........................................................................... 14 A. Things You Should Know Before Starting RACE PCR Reactions ......................................................14 B. PRoToCoL: Positive Control RACE PCR Experiment .................................................................14 C. Control PCR Reactions ....................................................................................................................16 D. PRoToCoL: Rapid Amplification of cDNA Ends (RACE) ............................................................17 VII. Characterization of RACE Products .....................................................................................20 A. Comparison of RACE Products obtained with GSPs & NGSPs ......................................................20 B. Southern Blot Analysis ......................................................................................................................20 C. PRoToCoL: NucleoTrap® Gel Extraction .....................................................................................21 D. Cloning & Sequencing RACE Products ............................................................................................22 VIII. Troubleshooting Guide .........................................................................................................23 IX. References ..............................................................................................................................27 Appendix A: Detailed Flow Chart of 5’ RACE ............................................................................28 Appendix B: Detailed Flow Chart of 3’ RACE ............................................................................29 Appendix C: Suppression PCR and Step-Out PCR ....................................................................30 Appendix D: 5’-RACE cDNA Amplification with Random Primers ..........................................32 Table of Contents List of Figures Figure 1. Mechanism of SMARTer cDNA synthesis .................................................................................. 5 Figure 2. overview of the SMARTer RACE procedure. ............................................................................. 6 Figure 3. The relationship of gene-specific primers to the cDNA template. ................................................ 8 Figure 4. 5’- and 3’-RACE sample results ................................................................................................16 Figure 5. Detailed mechanism of the 5’-RACE reactions. ........................................................................28 Figure 6. Detailed mechanism of the 3’-RACE reactions. ........................................................................29 Figure 7. Mechanisms of suppression PCR and step-out PCR .................................................................31 List of Tables Table I: Additional 5’-RACE Sequence obtained with SMART Technology ............................................ 5 Table II: SMARTer RACE Protocol overview ........................................................................................... 7 Table III: Setting Up the Positive Control RACE Experiment .................................................................15 Table IV: Setting Up the 5’-RACE PCR Reactions ..................................................................................17 Table V: Setting Up the 3’-RACE PCR Reactions ...................................................................................18 Table VI: Troubleshooting Guide ............................................................................................................23 Clontech Laboratories, Inc. www.clontech.com Protocol No. PT4096-1 A Takara Bio Company Version No. PR053541 3 SMARTer™ RACE cDNA Amplification Kit User Manual I. List of Components Cat. No. Cat. No. 634923 634924 10 rxns 20 rxns First-Strand cDNA Synthesis 10 µl 2x10 µl • SMARTer II A Oligonucleotide (12 µM) 5'–AAGCAGTGGTATCAACGCAGAGTACXXXXX–3' (X = undisclosed base in the proprietary SMARTer oligo sequence) 10 µl 20 µl • 3'-RACE CDS Primer A (3'-CDS; 12 µM) 5'–AAGCAGTGGTATCAACGCAGAGTAC(T)30 V N–3' (N = A, C, G, or T; V = A, G, or C) 10 µl 20 µl • 5'-RACE CDS Primer A (5'-CDS; 12 µM) 5'–(T)25V N–3' (N = A, C, G, or T; V = A, G, or C) 10 µl 20 µl • 10X Random Primer Mix (N-15) (20 µM) 40 µl 80 µl • 5X First-Strand Buffer (RNAse-Free) 250 mM Tris-HCl (pH 8.3) 375 mM KCl 30 mM MgCl2 20 µl 40 µl • Dithiothreitol (DTT; 20 mM) 1 ml 1 ml • Deionized H2O 10 µl 10 µl • RNase Inhibitor (40 U/µl) 12 µl 25 µl • SMARTScribe™ Reverse Transcriptase (100 U/µl) 5'- & 3'-RACE PCR 400 µl 800 µl • 10X Universal Primer A Mix (UPM) Long (0.4 µM): 5'–CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3' Short (2 µM): 5'–CTAATACGACTCACTATAGGGC–3' 50 µl 100 µl • Nested Universal Primer A (NUP; 10 µM) 5'–AAGCAGTGGTATCAACGCAGAGT–3'Control Reagents 5 µl 5 µl • Control Mouse Heart Total RNA (1 µg/µl) 25 µl 50 µl • Control 5'-RACE TFR Primer (10 µM) 25 µl 50 µl • Control 3'-RACE TFR Primer (10 µM) General Reagents 100 µl 200 µl • dNTP Mix (dATP, dCTP, dGTP, and dTTP, each at 10 mM) 2x1 ml 2x1 ml • Tricine-EDTA Buffer 10 mM Tricine-KOH (pH 8.5) 1.0 mM EDTA SMARTer™ RACE cDNA Amplification Kit User Manual Protocol No. PT4096-1 www.clontech.com Clontech Laboratories, Inc. Version No. PR053541 A Takara Bio Company 4 I. List of Components, continued Cat. No. Cat. No. 634923 634924 10 rxns 20 rxns NucleoTrap® Gel Extraction Kit 100 µl 2x100 µl • NucleoTrap Suspension 6 ml 2x6 ml • Buffer NT1 6 ml 2x6 ml • Buffer NT2 7 ml 2x7 ml • Buffer NT3 (concentrate) 5 ml 2x5 ml • Buffer NE Storage Conditions Store Control Mouse Heart Total RNA and SMARTer II A Oligonucleotide at –70°C. • Store the NucleoTrap Gel Extraction Kit at room temperature.• Store all other reagents at –20°C.• II. Additional Materials Required The SMARTer RACE cDNA Amplification Kit does not include a PCR polymerase. We recommend that you perform your SMARTer RACE PCR reactions using the following kit or polymerase mix: Advantage• ® 2 PCR Kit (Cat. Nos. 639206 & 639207) Advantage 2 Polymerase Mix• (Cat. Nos. 639201 & 639202) Advantage 2 is comprised of TITANIUM™ Taq DNA Polymerase—a nuclease-deficient N-terminal de- letion of Taq DNA polymerase plus TaqStart® Antibody to provide automatic hot-start PCR (Kellogg et al., 1994)—and a minor amount of a proofreading polymerase. Advantage 2 technology enables you to perform long distance PCR (LD PCR) reactions with confidence that your products will have high fidelity to the original sequences (Barnes, 1994; Cheng et al., 1994). The following reagents are optional: For efficient amplification of GC-rich templates, we recommend: Advantage GC 2 PCR Kit• (Cat. Nos. 639119 & 639120) For applications in which the highest fidelity product is desired, we recommend: Advantage HF 2 PCR Kit• (Cat. Nos. 639123 & 639124) If your RNA template is from a non-eukaryotic organism and lacks a polyadenylated tail, you can add one prior to first-strand cDNA synthesis using the following enzyme: Poly(A) Polymerase• (Takara Bio Cat. No. 2180A) Clontech Laboratories, Inc. www.clontech.com Protocol No. PT4096-1 A Takara Bio Company Version No. PR053541 5 SMARTer™ RACE cDNA Amplification Kit User Manual III. Introduction & Protocol Overview The SMARTer™ RACE cDNA Amplification Kit provides a method for performing both 5’- and 3’-rapid amplification of cDNA ends (RACE). The SMARTer RACE cDNA Amplification Kit is an improved version of our original SMART RACE Kit, with a new, SMARTer II A oligonucleotide and SMARTScribe™ Reverse Transcriptase included; it provides better sensitivity, less background and higher specificity. This powerful system allows you to isolate the complete 5’ sequence of your target transcript from as little as 10 ng of total RNA. The cornerstone of the SMARTer RACE cDNA Amplification Kit is SMART technology, which eliminates the need for problematic adaptor ligation and lets you use first-strand cDNA directly in RACE PCR, a benefit that makes RACE far less complex and much faster (Chenchik et al., 1998). Additionally, the SMARTer RACE Kit exploits Clontech’s patented suppression PCR & step-out PCR to increase the sensitivity and reduce the background of the RACE reactions. As a result you can use either poly A+ or total RNA as starting material for constructing full-length cDNAs of even very rare transcripts. SMART technology provides a mechanism for generating full-length cDNAs in reverse transcription reactions (Zhu et al., 2001). This is made possible by the joint action of the SMARTer II A Oligonucleotide and SMARTScribe Reverse Transcriptase (a variant of MMLV RT). The SMARTScribe RT, upon reaching the end of an RNA template, exhibits terminal transferase activity, adding 3–5 residues to the 3’ end of the first-strand cDNA (Figure 1). The SMARTer oligo contains a terminal stretch of modified bases that anneal to the extended cDNA tail, allowing the oligo to serve as a template for the RT. SMARTScribe R T switches templates from the mRNA molecule to the SMARTer oligo, generating a complete cDNA copy of the original RNA with the additional SMARTer sequence at the end. Since the template switching activity of the RT occurs only when the enzyme reaches the end of the RNA template, the SMARTer sequence is typically only incorporated into full-length, first-strand cDNAs. For more information about SMART technology, read "Generation and use of high-quality cDNA from small amounts of total RNA by SMART PCR" (Chenchik et al., 1998). This process guarantees that the use of high quality RNA will result in the formation of a set of cDNAs that have a maximum amount of 5’ sequence (Table I). Table I: Additional 5’-RACE Sequence Obtained with SMART Technology Human gene Size of mRNA (kb) Additional sequence (bp)* Matches genomic sequences Includes transcription start site Transferrin receptor 5.0 +25 yes yes Smooth muscle g-actin 1.28 +31 yes yes Vascular smooth muscle α-actin 1.33 +17 yes yes Cytoskeletal γ-actin 1.9 +1 yes yes 23 kDa HBP 0.67 +9 yes yes p53 2.6 +4 yes yes Interferon-γ receptor 2.06 +14 yes yes 14-3-3 protein 1.03 +1 n/a n/a Interferon-α receptor 2.75 +17 yes yes n/a = not available * Compared to GenBank cDNA sequence. 5' First-strand synthesis coupled with tailing by SMARTScribe RT Poly A+ RNA polyA 3' 5' SMARTer II A Oligonucleotide Oligo (dT) primer Template switching and extension by SMARTScribe RT polyA polyAXXXXX5' XXXXX 5' XXXXX 5' XXXXX XXXXX Figure 1. Mechanism of SMARTer cDNA synthesis. First- strand synthesis is primed using a modified oligo(dT) primer. After SMARTScribe Reverse Transcriptase (RT) reaches the end of the mRNA template, it adds several nontemplate residues. The SMARTer II A Oligonucleotide anneals to the tail of the cDNA and serves as an extend- ed template for SMARTScribe RT. SMARTer™ RACE cDNA Amplification Kit User Manual Protocol No. PT4096-1 www.clontech.com Clontech Laboratories, Inc. Version No. PR053541 A Takara Bio Company 6 III. Introduction & Protocol Overview, continued Following reverse transcription, SMART technology allows first-strand cDNA to be used directly in 5’- and 3’-RACE PCR reactions. Incorporation of universal primer binding sites in a single-step during first-strand cDNA synthesis eliminates the need for tedious second-strand synthesis and adaptor ligation. This simple and highly efficient SMARTer cDNA synthesis method ensures higher specificity in amplifying your target cDNA. Suppression PCR & step-out PCR techniques (described in detail in Appendix C) are used in combi- nation with SMARTer technology to decrease background amplification in RACE PCR. The only requirement for SMARTer RACE cDNA amplification is that you know at least 23–28 nucleotides (nt) of sequence information in order to design gene-specific primers (GSPs) for the 5’- and 3’-RACE reactions. (Additional sequence information will facilitate analysis of your RACE products.) This limited requirement makes SMARTer RACE ideal for characterizing genes identified through diverse methods, including cDNA subtraction, differential display, RNA fingerprinting, ESTs, library screening, and more. SMARTer RACE cDNA amplification is a flexible tool—many researchers use this kit in place of conventional kits to amplify just the 5’ or 3’ end of a particular cDNA. Others perform both 5’- and 3’-RACE, and many then go on to clone full-length cDNAs using one of the two methods described in the latter part of this protocol. In many cases, researchers obtain full-length cDNAs without ever constructing or screening a cDNA library. SMARTer first-strand cDNA synthesis (Section V) Standard first-strand cDNA synthesis (Section V) 5'-RACE-Ready cDNA 3'-RACE fragment 5'-RACE PCR (Section VI) 3'-RACE PCR (Section VI) Clone and sequence RACE fragments (Section VII) Poly A+ or Total RNA 3'-RACE-Ready cDNA 5'-RACE fragment Full-length cDNA Conventional Cloning Cloned RACE fragments End-to-end PCR 1–2 Days Figure 2. Overview of the SMARTer RACE procedure. Detailed flow charts of the SMARTer RACE mechanisms can be found in Appendices A & B. Note that with the cloned RACE fragments you can use a restriction site in an overlapping region to construct a full-length cDNA by subcloning. Alternatively, you can sequence the 5' end of the 5' product and the 3' end of the 3' product to obtain the sequences of the extreme ends of the transcript. Using this information, you can design 5' and 3' gene-specific primers to use in LD PCR with the 5'-RACE- Ready cDNA as template to generate the full-length cDNA. Clontech Laboratories, Inc. www.clontech.com Protocol No. PT4096-1 A Takara Bio Company Version No. PR053541 7 SMARTer™ RACE cDNA Amplification Kit User Manual III. Introduction & Protocol Overview, continued The table below describes the major steps necessary to generate RACE-ready cDNA, perform 5’ & 3’ RACE PCR reactions, and characterize the final RACE products using the SMARTer RACE cDNA Amplification Kit. Please refer to the specified sections for details on performing each step. Detailed mechanisms of the RACE reactions are provided in Appendices A & B. Table II: SMARTer RACE Protocol Overview Step Description Section Primer Design You must design gene-specific primers for the 5’- and/or 3’-RACE reactions (GSP1 and GSP2, respectively). As described, nested primers (NGSP1 and NGSP2) will facilitate analy- sis of your RACE products. They can also be used for nested RACE PCR if necessary. Primer design is discussed in detail in Section IV; Figure 3 shows the relationship of primers and template used in SMARTer RACE reactions. IV Check the Quality of your RNA Template The purity of RNA is the key factor for successful cDNA synthesis and SMARTer RACE. Prior to cDNA synthesis, you must make sure that your RNA is intact and free of contaminants. V.C RACE-Ready First-Strand cDNA Synthesis Since the 5’ elongation benefits of SMART technology are only relevant for 5’-RACE, the SMARTer RACE Kit includes a protocol for the synthesis of two separate cDNA populations: 5’-RACE-Ready cDNA and 3’-RACE-Ready cDNA. The 5’-RACE cDNA is synthesized using a modified lock-docking oligo(dT) primer and the SMARTer II A oligo as described above. The modified oligo(dT) primer, termed the 5’-RACE CDS Primer A (5’-CDS), has two degenerate nucleotide positions at the 3’ end. These nucleotides position the primer at the start of the poly A+ tail and thus eliminate the 3’ heterogeneity inherent with conventional oligo(dT) priming (Borson et al., 1994). The 3’-RACE cDNA is synthesized using a traditional reverse transcription procedure, but with a special oligo(dT) primer. This 3’-RACE CDS Primer A (3’-CDS) primer includes the lock-docking nucleotide positions as in the 5’-CDS primer and also has a portion of the SMARTer sequence at its 5’ end. By incorporating the SMARTer sequence into both the 5’- and 3’-RACE-Ready cDNA populations, you can prime both RACE PCR reactions using the Universal Primer A Mix (UPM), which recognizes the SMARTer sequence, in conjunc- tion with distinct gene-specific primers. Alternatively, non-poly A+ RNA can be primed with random primers using the protocol in Appendix D. V.D Positive Control RACE Experiment Prior to performing RACE with your template, we strongly recommend that you perform the positive control RACE experiment using the Control Mouse Heart Total RNA provided in the kit. VI.B 5’ & 3’ RACE PCR Reactions After you generate RACE-Ready cDNAs, you will have enough material to perform 5’– and 3’–RACE with different genes, simply by using different gene-specific primers. All PCR re- actions in the SMARTer RACE protocol are optimized for use with the Advantage® 2 Poly- merase Mix. Advantage 2 provides an automatic hot-start, and enables you to perform long distance PCR (LD PCR) reactions with confidence that your