论文集2

Copyright WILEY‐VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2012.  Supporting Information    for Adv. Mater., DOI: 10.1002/adma. 201104797    Near‐Infrared Light‐Triggered, Targeted Drug Delivery to Cancer Cells by  Aptamer Gated Nanovehicles     Xinjian   Yang ,     Xia   Liu ,     Zhen   Liu ,     Fang   Pu ,     Jinsong   Ren , *           and   Xiaogang   Qu *  Submitted to 1 Supporting Information Near-Infrared Light-Triggered, Targeted Drug Delivery to Cancer Cells by Aptamer Gated Nanovehicles Experimental Section: Reagents and Materials: Nanopure water (18.2 MΩ; Millpore Co., USA) was used in all experiments and to prepare all buffers. Tetraethylorthosilicate (TEOS), sodium hydroxide, (3- aminopropyl)trimethoxysilane (APTES), 4-morpholineethanesulfonic acid (MES) Sodium borohydride (NaBH4), ascorbic acid, silver nitrate (AgNO3) and tetrachloroauric acid (HAuCl4) were purchased from Sigma-Aldrich. N-cetyltrimethylammonium bromide (CTAB), fluorescein isothiocyanate (FITC)， fluorescein and succinic anhydride were obtained from Alfa Aesar. All the chemicals were used as received without further purification. The oligonucleotides used in this paper were purchased by (Shanghai Sangon Biological Engineering Technology & Services Co.). The sequences are as follows: DNA-1: NH2-(CH2)6-TGGTCTACTTGA DNA-2: GGTGGTGGTGGTTGTGGTGGTGGTGGTCAAGTAGACCA General Techniques: FT-IR, SEM, TEM, N2 adsorption-desorption, and UV-visible spectroscopy were employed to characterize the materials obtained. FT-IR analyses were carried out on a Bruker Vertex 70 FT-IR Spectrometer. SEM images were obtained with a Hitachi S-4800 FE-SEM. TEM images were recorded using a FEI TECNAI G2 20 high- resolution transmission electron microscope operating at 200 kV. N2 adsorption-desorption isotherms were recorded on a Micromeritics ASAP 2020M automated sorption analyzer. The samples were degassed at 150 ºC for 5 h. The specific surface areas were calculated from the adsorption data in the low pressure range using the BET model and pore size was determined Submitted to 2 following the BJH method. UV-vis spectroscopy was carried out with a JASCO V-550 UV/vis spectrometer. Melting experiments were carried out on a Cary 300 UV/Vis spectrophotometer equipped with a Peltier temperature control accessory at a heating rate of 1 ºC·min-1. Fluorescence measurements were carried out on a JASCO FP-6500 spectrofluorometer. A CWdiode laser (LSR808NL-2000) with wavelength of 808 nm was used for the laser irradiation experiment. Preparation of Au nanorods: CTAB solution (1.0 mL, 0.20 M) was mixed with 1.0 mL of 0.5 mM HAuCl4. To the stirred solution, 0.12 mL of ice-cold 0.01 M NaBH4 was added, which resulted in the formation of a brownish-yellow solution. Vigorous stirring of the seed solution was continued for 2 minutes. After the solution was stirred, it was kept at 25 ºC. The growth solution was prepared by mixing together in 250 ml flask 100 mL of 0.2 M CTAB, 5.6 mL of 4 mM AgNO3, 6.5 mL of 23 mM HAuCl4 and 95 mL of Milli-Q water. Ascorbic acid (0.08 M) approximately 2.5 mL was slowly added to the mixture. The addition of ascorbic acid was conducted dropwise, until the mixture became colorless after which one quarter more of the total number of droplets to that point was added. The final step was the addition of 1.8 mL of the seed solution to the growth solution at 27-30 ºC. The color of the solution gradually changed within 10-20 minutes. The temperature of the growth medium was kept constant at 27-30 ºC during the full procedure. Coating Au nanorods with porous silica: The as-synthesized Au nanorods were centrifuged 75 mL aliquots to remove excess CTAB surfactant at a time, at 12,500 rpm for 25 minutes. After discarding the supernatant, the precipitate was dispersed in 50 mL of Milli-Q water. 500µL of 0.1 M NaOH solution was added upon stirring. Following this step, three 150µL injections of 20% TEOS in methanol was added under gentle stirring at 30-60 minute intervals. The reaction mixture was reacted for 6 h. To get amido modified nanopatices( AuMPs-1), 10µL APTES in 100µL methanol was added under stirring for another 5h. Red precipitate was got after centrifugation twice. To remove the surfactant Submitted to 3 template (CTAB), the red precipitate was refluxed for 1h in a solution of 0.2 mL of HCl (37%) and 20 mL of methanol followed by extensively washing with hot methanol. The resulting surfactant-removed AuMPs was placed under high vacuum to remove the remaining solvent in the mesopores. As for fluorescein-labeled nanoparticles, fluorescein isothiocyanate (FITC, 1 mg) was reacted with 22 µL of APTES in 1 mL ethanol for 2h in the dark. Then 100 µL was added to the coating solution after the third adding of 20% TEOS with the same condition as before. Chemical Modification of the AuMPs Surface: The carboxylic acid-functionalized particles (AuMPs-2) were obtained by reacting succinic anhydride (0.20 g) with AuMPs-1(10 mg) in DMSO solution in the presence of triethylamine (0.1g). The resultant was purified by centrifugation and washed with ethanol. The carboxylated nanoparticles were activated using EDC (10 mg/ml, 15 mL) and sulfo-NHS (10 mg/mL, 5 ml) in a MES buffer (pH 6.0) for 15 min at room temperature with continuous stirring. Then the pH was adjusted to 7.4 followed by the addition of DNA-1 at room temperature with continuous stirring for 6 h and washing in PBS buffer (0.1 M, pH 7.4) to form the resultant DNA-conjugated nanoparticles (AuMPs-3). Guest loading and release experiments: The purified AuMPs-3 was incubated in the PBS buffer (25mM, 50mM KCl, pH=7.4) of Flu (0.25 mM) for 24h followed by centrifuging and repeated washing with PBS buffer to remove physisorbed Flu molecules from the exterior surface of the material. Then the drug loaded materials was incubated with DNA-2 (AuMPs- 4) in PBS buffer to form G-quart structure followed by two cycles of centrifugation and washing with PBS buffer. All the washing solutions were collected, and the loading of dye was calculated from the difference in the concentration of the initial and left dye. Flu loaded AuMPs-4 (1 mg/mL) was placed in one corner of the cuvette and PBS (25mM, 50mM KCl, pH=7.4) was added carefully to prevent particles from mixing into the solution. An excitation laser of 808 nm is exposed on the nanoparticles to excite release dye. The fluorescence signal Submitted to 4 (520 nm) in the supernatant was determined in order to monitor the release kinetics of the dye molecules. Cell culture: The human breast cancer MCF-7 cells and Mouse embryonic fibroblast NIH3T3 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10 % (v/v) fetal bovine serum (Gibco). The cells were kept at 37 ºC in a humidified atmosphere containing 5 % CO2. In Vitro Photothermal heat triggered drug delivery: MCF-7 cells were plated in 96-well culture plates (1×105 cells/well) separately. After 24 h, drugs (suspended in 2 % DMEM) at the indicated concentrations were added and AuMP-free control treatments received only 2 % DMEM. At 4 h after incubation, excess unbound AuMP were removed by rinsing three times with PBS. Fresh culture medium was then added to the wells. The Cells were exposed to NIR light (0.6 W/cm2 and 1.2 W/cm2) for 10 min for photothermal and chemo-phothermal treatments, and then incubated again at 37 °C with 5% CO2 for 24 h. After treatment, MTT solution (5 mg/mL) was added to each well of the microtiter plate and the plate was incubated in the CO2 incubator for an additional 4 h. The cells then were lysed by the addition of 100 μL of DMSO. Absorbance values of formazan were determined with Bio-Rad model-680 microplate reader at 490 nm (corrected for background absorbance at 630 nm). Six replicates were done for each treatment group. Fluorescence microscopy: The endocytosis efficiency was quantified by the fluorescence of MCF-7 cells using FITC modified AuMP. MCF-7 and NIH3T3 cells were fixed at a density of 105 cells/well in 24-well assay plates separately. FITC-AuMPs-4 and FITC-AuMPs-3 (100 μg/mL) were added to the cells, the mixture was incubated at 37 ºC for 4 h. The cells were then washed twice with PBS, and pictures were taken with an Olympus digital camera. Submitted to 5 Figure S1 UV/vis spectrum of GNRs, AuMPs-1, AuMPs-2 and AuMPs-3. Figure S2 SEM image and nitrogen sorption isotherms of the AuMPs-1.Inset: pore distribution of AuMPs-1. SBET(m2g-1) Pore volume(cm3g-1) Pore size(nm) 547.4 0.3912 2.529 Table S1. BET specific surface values, pore volumes, and pore sizes calculated from the N2 adsorption-desporption isotherms of AuMPs-1. Submitted to 6 Figure S3 FTIR spectra of a) AuMPs-1 b) AuMPs-2 c) AuMPs-3. Figure S4. NIR-induced heat generation of GNRs and AuMPs at the same concentration. Irradiation power density is 1.5W/cm2. Submitted to 7 Figure S5 (a) Circular dichroism (CD) spectra and (b) UV melting spectra of the complex formed from 2μM DNA-1 and 2μM DNA-2 in PBS buffer (25 mM, 50mM KCl); (c) UV melting spectra of the G-quadruplex formed from 2μM DNA-2 at 295 nm and (d) 260 nm in PBS buffer (25mM, 50mM KCl). Figure S6. The cell viability upon NIR irradiation with different concentration of AuMPs-4 (a),15.2μg/mL, (b)76μg/ml and (c)152μg/ml, which corresponding to the 1μM，5μM and 10μM DOX used in the experiment. Submitted to 8 Figure S7.The cell viability of AuMPs-3 incubated with MCF-7. Figure S8. Fluorescence microscopy imaging showing the FITC-AuMPs-4 uptake into MCF- 7 cells. The yellow spots in the merged image (c) show the colocalization of the FITC- AuMPs-4 with Lyso-Tracker Red. Submitted to 9 Figure S9 Cytotoxicity assays of MCF-7 cells in absence and those incubated with808nm laser irradiation, DOX, AuMPs-4 + 808nm laser irradiation and DOX-AuMPs-4 upon 808 nm laser irradiation with a power density of 1.8 W/cm2 for 10 min.